Распространенность мутации CCR5 delta32 среди тундровых ненцев Ямала


Цитировать

Полный текст

Аннотация

CCR5 delta32 - генетический вариант CCR5, представляющий собой делецию 32 пар оснований, который приводит к нарушению адгезивных свойств кодируемого ею белка CCR5 Т-клеток. Предполагается, что эта мутация возникла примерно две с половиной тысячи лет назад и со временем распространилась в Европе. В гетерозиготном состоянии эта мутация сильно уменьшает шанс инфицирования клетки ВИЧ, в гомозиготном, по-видимому, приводит к полной невозможности инфицирования ВИЧ. Мутация CCR5 delta32 в гетерозиготном состоянии встречается в Европе с частотой 5-14 %. Встречаемость CCR5 delta32 за пределами Европы крайне мала, во многих неевропейских этнических группах она полностью отсутствует. Распространенность данной мутации в популяции ненцев ранее не исследовалась, предполагалось, что она должна быть ниже, чем у европейцев. Нами было проведено исследование 54 образцов крови ненцев, проживающих на территории Ямало-Ненецкого автономного округа. Для выделения ДНК использовался QIAamp DNA Mini Kit (QIAGEN) в соответствии с прилагаемым протоколом. С целью идентификации делеции CCR5 delta32 применялась полимеразная цепная реакция с применением праймеров: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` при следующих условиях: 95˚-5'x1; 95˚-15» → 55˚-15» → 72˚-60»x40; 72˚-10'x1 → 4˚- ∞; продукты реакции были разделены в 2%-м агарозном геле в течение 1,5 часов; гель-документирование проводилось с помощью Gel Doc XR Plus (Bio-Rad, США). По результатам проведенного исследования распространённость исследуемой мутации среди ненцев составила 9,3 %. Таким образом, распространенность мутации CCR5 delta32 среди ненцев, проживающих в Ямало-Ненецком округе, соответствует ее распространенности у европейцев. Это может свидетельствовать о европейском происхождении ненцев.

Ключевые слова

Полный текст

Introduction CCR5 delta 32 is agenetic variant of CCR5 receptor with 32 nucleotides deletion that affects its ligands binding. CCR5 is recognized as a number of cytokines including RANTES, MIP-1α and MIP-1β. These cytokines are expressed by immune cells, including NK-cells, T-lymphocytes, macrophages, and play a crucial role in the migration and activation of immune cells. Thus, any change in the sequence of the CCR5 gene or its expression can be associated with a dysfunction of the immune system and the development of autoimmune diseases [3]. CCR5 delta 32 mutation reduces number of CCR5 receptors on the surface of T lymphocytes. The CCR5 expression levels influence migration of inflammatory cells into the synovium and, as a result, the susceptibility to juvenile idiopathic arthritis [4]. In the heterozygotes this mutation significantly reduces HIV infection and in the homozygots it fully protects against HIV infection [12]. Meta-analysis data indicated that CCR5 delta32 polymorphism might act as a protective factor in type 1 diabetes development, and as a risk factor for Kawasaki disease and Behcet's disease [5, 10]. Coalescence theory analysis of modern haplotype genealogy placed the origin of the CCR5 delta32-containing ancestral haplotype at about 700 years ago, with an estimated range of 275-1875 years [11] in one study and 700-3500 years ago in the other study [8], and eventually spread to Europe. Analysis of all available data on CCR5 delta32 frequencies in the Old World allowed for construction of a geographical gene map to analyze possible correlations between allele frequencies and eight climatic-geographic parameters [6]. A strong positive correlation was found between the allele frequency and latitude, a strong negative correlation with annual radiation balance, and a weaker negative correlation with longitude. Exclusion of latitude reduced the negative correlation between the allele frequency and annual radiation balance, but it still remained large and significant. The existence of correlations between the cline of CCR5 delta32 frequencies and climatic-geographic parameters suggest for an effect of either natural environmental factors or large-scale population movements on the distribution of this allele [6]. Distribution of CCR5 gene mutations in populations has distinct ethnic and racial features. The geographic cline of CCR5 delta32 frequencies and its recent emergence are consistent with a historic strong selective event such as an epidemic of a pathogen similar to HIV-1 that utilizes CCR5 therefore driving its frequency upward in ancestral Caucasian populations (Table 1) [11]. Frequency of CCR5 delta 32 allele in 16 European populations was found to form a gradient from north to south with the highest frequency of the allele in Denmark and lowest in Corsica [7]. Prevalence of CCR5 delta 32 outside of Europe is extremely low and in many non-European ethnic groups it is completely absent [9]. Distribution of allele frequencies of CCR5 delta 32 in Russia shows clinal variability from the north to the southeast, with the highest frequency in Pomors (Figure 1) [1]. Deletion of 32 base pairs of the C-C chemokine receptor type 5 was not detected in Yakut [2]. The prevalence of the CCR 5 delta 32 mutations in other ethnic groups of the Far North of Russia has not been previously determined. Objective To determine the prevalence of the CCR5 delta 32 mutation in the population of the Nenets. Based on the previously conducted studies, prevalence of CCR5 delta 32 mutation was expected to be significantly lower than in Europeans populations. Materials and methods The materials for the study were 54 blood samples (dried on filter paper) of Tundra Nenets children living in boarding Seyaha village, Yamal-Nenets Autonomous District. DNA was isolated using QIAamp Mini Kit (QIAGEN) according to the attached protocol. To identify deletions CCR5 delta32 used polymerase chain reaction with the flanking primers: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` under the following conditions 95˚-5'x1; [95˚-15»→55˚-15»→72˚-60»]x40; 72˚-10'x1→4˚-∞; products of the reaction were separated on 2 % agarose gels for 1.5 hours; gel documentation was carried out using a Gel Doc XR Plus (Bio-Rad). As a result of PCR amplification are produced two fragments 196 bp - wild type and 164 bp - delta32 mutation (Figure 2). Results CCR5 delta 32 mutation in heterozygous form was detected in 5 children, and homozygous mutations were not found at all. Therefore we found the prevalence of heterozygous form of CCR5 delta 32 mutation in Nenets population to be 9.3 %. Discussion/conclusion Prevalence of CCR5 delta32 mutation was expected to be significantly lower than among Europeans. However, the prevalence of the studied allele among Nenets living in the Yamal-Nenets Autonomous District, was close to the average prevalence among Europeans. Nenets belong to the so-called “Samoyed” people (corrupted self-reference Saamoa) which is the same as Saami (formerly Lapps or Lapons) in Finland (Suomi - the Finnish name for Finland), or transliterated into English Samodi. Saamoa speak the Samoyedic language which is a branch of the Uralic language family and it is known they moved from farther south in Siberia to the northernmost part of what later became Russia before the 12th century [12]. It is known that the allele CCR5 delta32 is rare in African, Asian, Middle Eastern, and American Indian populations, suggesting its recent origin [11]. It is assumed that high frequency of CCR5 delta32 mutation in Europe is a results of strong selection from bubonic plague (11). This hypothesis is popular in population genetic and medical literature, though quantitative assessment is absent. Three lines of evidence (predictions from a population genetic model, the geographical distribution of the allele, and the clinical effect of the deletion) indicate that the smallpox Variola major virus is a more likely candidate [13]. It is known that the population of people living in the northernmost part of Siberia declined tremendously after several outbreaks of smallpox [14], though little is known about the outbreaks of plague [14]. Our results support the hypothesis that the high frequency of the variant of this allele in European and in Yamal populations arose through strong selection from rather smallpox than from plague.
×

Об авторах

Татьяна Аммосова

Университет Говарда

Email: tatiana.ammosova@howard.edu
канд. мед. наук, научный сотрудник, Центр серповидноклеточной анемии

Андрей Сергеевич Егоров

ГБОУ ВПО СПбГПМУ Минздрава России

Email: egorov.doc@gmail.com
ассистент, кафедра госпитальной педиатрии

Елена Владимировна Федорова

ГБОУ ВПО СПбГПМУ Минздрава России

Email: detymedic@mail.ru
аспирант, кафедра госпитальной педиатрии

Сергей Львович Аврусин

ГБОУ ВПО СПбГПМУ Минздрава России

Email: avrusin4@gmail.com
канд. мед. наук, доцент, кафедра госпитальной педиатрии

Андрей Вячеславович Сантимов

ГБОУ ВПО СПбГПМУ Минздрава России

Email: a.santimoff@gmail.com
аспирант, кафедра госпитальной педиатрии

Сергей Нехай

Университет Говарда

Email: snekhai@howard.edu
канд. физ. наук, доцент, Центр серповидноклеточной анемии

Список литературы

  1. Kofiadi I. A. Geneticheskaya ustoychivost' k zarazheniyu VICh i razvitiyu SPID v populyatsiyakh Rossii i sopredel'nykh gosudarstv [Genetic resistance to HIV infection and development of AIDS in populations of Russia and neighboring countries]. Avtoref. dis. na soisk. uch. st. kand. biol. nauk. M.; 2008. Available from: http://www.dna-technology.ru/files/images/d/0b136b567d25d4be1dfa26a8b39ec2b9.pdf (accessed 18.09.2014).
  2. Nikolaeva I. A., Maksimova N. R., Nikolaeva T. Ya., Puzyrev V. P. Deletsionnyy polimorfizm gena retseptora khemokina 5 i risk razvitiya rasseyannogo skleroza v Yakutii [Deletion polymorphism in the gene for the receptor of the chemokine 5 and the risk of developing multiple sclerosis in Yakutia]. Yakutskiy meditsinskiy zhurnal. 2007; 2 (18): 10-12.
  3. Ghorban K., Dadmanesh M., Hassanshahi G., Momeni M., Zare-Bidaki M., Arababadi M. K., Kennedy D. Is the CCR5 Δ 32 mutation associated with immune system-related diseases? Inflammation. 2013; 36 (3): 633-42.
  4. Hinks A., Martin P., Flynn E., Eyre S., Packham J. Childhood Arthritis Prospective Study (CAPS), UKRAG Consortium, BSPAR Study Group, Barton A., Worthington J., Thomson W. Association of the CCR5 gene with juvenile idiopathic arthritis. Genes Immun. 2010; 11 (7): 584-89.
  5. Lee Y. H., Kim J. H., Song G. G. Chemokine receptor 5 Δ32 polymorphism and systemic lupus erythematosus, vasculitis, and primary Sjogren's syndrome: Meta-analysis of possible associations. Z Rheumatol. 2014; Mar 7. Available from: http://link.springer.com/article/10.1007 %2Fs00393-014-1356-5 (accessed 18.09.2014).
  6. Limborska S. A., Balanovsky O. P., Balanovskaya E. V., Slominsky P. A., Schadrina M. I., Livshits L. A., Kravchenko S. A., Pampuha V. M., Khusnutdinova E. K., Spitsyn V. A. Analysis of CCR5Delta32 geographic distribution and its correlation with some climatic and geographic factors. Hum Hered. 2002; 53 (1): 49-54.
  7. Lucotte G., Mercier G. Distribution of the CCR5 gene 32-bp deletion in Europe. J Acquir Immune Defic Syndr Hum Retrovirol. 1998; 19 (2): 174-77.
  8. Novembre J., Galvani A. P., Slatkin M. The Geographic Spread of the CCR5 Δ32 HIV-Resistance Allele PLoS Biol. 2005; 3 (11): e339.
  9. Sabeti P. C., Walsh E., Schaffner S. F., Varilly P., Fry B., Hutcheson H. B., Cullen M., Mikkelsen T. S., Roy J., Patterson N., Cooper R., Reich D., Altshuler D., O'Brien S., Lander E. S. The case for selection at CCR5-Delta32. PLoS Biol. 2005; 3 (11): e378.
  10. Song G. G., Kim J. H., Lee Y. H. The chemokine receptor 5 delta32 polymorphism and type 1 diabetes, Behcet's disease, and asthma: a meta-analysis. Immunol Invest. 2014; 43 (2): 123-36.
  11. Stephens J. C., Reich D. E., Goldstein D. B., Shin H. D., Smith M. W., Carrington M., Winkler C., Huttley G. A., Allikmets R., Schriml L., Gerrard B., Malasky M., Ramos M. D., Morlot S., Tzetis M., Oddoux C., di Giovine F. S., Nasioulas G., Chandler D., Aseev M., Hanson M., Kalaydjieva L., Glavac D., Gasparini P., Kanavakis E., Claustres M., Kambouris M., Ostrer H., Duff G., Baranov V., Sibul H., Metspalu A., Goldman D., Martin N., Duffy D., Schmidtke J., Estivill X., O'Brien S. J., Dean M. Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. Am J Hum Genet. 1998; 62 (6): 1507-1515.
  12. Golovnev A. V., Osherenko G. Siberian survival. Nenets and their story. Cornel Univ. Press; 1999.
  13. Galvany A. P., Slatkin M. Evaluating plague and smallpox as historical selective pressures for the CCR5-delta32 HIV-resistance allele. Proc Natl Acad Sci USA. 2003; 100 (25): 15276-279.
  14. Forsyth J. A history of the peoples of Siberia: Russia's North Asian Colony 1581-1990. Cambridge University Press.; 1992.

Дополнительные файлы

Доп. файлы
Действие
1. JATS XML

© Аммосова Т., Егоров А.С., Федорова Е.В., Аврусин С.Л., Сантимов А.В., Нехай С., 2014

Creative Commons License
Эта статья доступна по лицензии Creative Commons Attribution 4.0 International License.
 


Согласие на обработку персональных данных с помощью сервиса «Яндекс.Метрика»

1. Я (далее – «Пользователь» или «Субъект персональных данных»), осуществляя использование сайта https://journals.rcsi.science/ (далее – «Сайт»), подтверждая свою полную дееспособность даю согласие на обработку персональных данных с использованием средств автоматизации Оператору - федеральному государственному бюджетному учреждению «Российский центр научной информации» (РЦНИ), далее – «Оператор», расположенному по адресу: 119991, г. Москва, Ленинский просп., д.32А, со следующими условиями.

2. Категории обрабатываемых данных: файлы «cookies» (куки-файлы). Файлы «cookie» – это небольшой текстовый файл, который веб-сервер может хранить в браузере Пользователя. Данные файлы веб-сервер загружает на устройство Пользователя при посещении им Сайта. При каждом следующем посещении Пользователем Сайта «cookie» файлы отправляются на Сайт Оператора. Данные файлы позволяют Сайту распознавать устройство Пользователя. Содержимое такого файла может как относиться, так и не относиться к персональным данным, в зависимости от того, содержит ли такой файл персональные данные или содержит обезличенные технические данные.

3. Цель обработки персональных данных: анализ пользовательской активности с помощью сервиса «Яндекс.Метрика».

4. Категории субъектов персональных данных: все Пользователи Сайта, которые дали согласие на обработку файлов «cookie».

5. Способы обработки: сбор, запись, систематизация, накопление, хранение, уточнение (обновление, изменение), извлечение, использование, передача (доступ, предоставление), блокирование, удаление, уничтожение персональных данных.

6. Срок обработки и хранения: до получения от Субъекта персональных данных требования о прекращении обработки/отзыва согласия.

7. Способ отзыва: заявление об отзыве в письменном виде путём его направления на адрес электронной почты Оператора: info@rcsi.science или путем письменного обращения по юридическому адресу: 119991, г. Москва, Ленинский просп., д.32А

8. Субъект персональных данных вправе запретить своему оборудованию прием этих данных или ограничить прием этих данных. При отказе от получения таких данных или при ограничении приема данных некоторые функции Сайта могут работать некорректно. Субъект персональных данных обязуется сам настроить свое оборудование таким способом, чтобы оно обеспечивало адекватный его желаниям режим работы и уровень защиты данных файлов «cookie», Оператор не предоставляет технологических и правовых консультаций на темы подобного характера.

9. Порядок уничтожения персональных данных при достижении цели их обработки или при наступлении иных законных оснований определяется Оператором в соответствии с законодательством Российской Федерации.

10. Я согласен/согласна квалифицировать в качестве своей простой электронной подписи под настоящим Согласием и под Политикой обработки персональных данных выполнение мною следующего действия на сайте: https://journals.rcsi.science/ нажатие мною на интерфейсе с текстом: «Сайт использует сервис «Яндекс.Метрика» (который использует файлы «cookie») на элемент с текстом «Принять и продолжить».