Prevalence of the CCR5 delta32 mutation in the tundra Nenets of Yamal

Full Text

Introduction CCR5 delta 32 is agenetic variant of CCR5 receptor with 32 nucleotides deletion that affects its ligands binding. CCR5 is recognized as a number of cytokines including RANTES, MIP-1α and MIP-1β. These cytokines are expressed by immune cells, including NK-cells, T-lymphocytes, macrophages, and play a crucial role in the migration and activation of immune cells. Thus, any change in the sequence of the CCR5 gene or its expression can be associated with a dysfunction of the immune system and the development of autoimmune diseases [3]. CCR5 delta 32 mutation reduces number of CCR5 receptors on the surface of T lymphocytes. The CCR5 expression levels influence migration of inflammatory cells into the synovium and, as a result, the susceptibility to juvenile idiopathic arthritis [4]. In the heterozygotes this mutation significantly reduces HIV infection and in the homozygots it fully protects against HIV infection [12]. Meta-analysis data indicated that CCR5 delta32 polymorphism might act as a protective factor in type 1 diabetes development, and as a risk factor for Kawasaki disease and Behcet's disease [5, 10]. Coalescence theory analysis of modern haplotype genealogy placed the origin of the CCR5 delta32-containing ancestral haplotype at about 700 years ago, with an estimated range of 275-1875 years [11] in one study and 700-3500 years ago in the other study [8], and eventually spread to Europe. Analysis of all available data on CCR5 delta32 frequencies in the Old World allowed for construction of a geographical gene map to analyze possible correlations between allele frequencies and eight climatic-geographic parameters [6]. A strong positive correlation was found between the allele frequency and latitude, a strong negative correlation with annual radiation balance, and a weaker negative correlation with longitude. Exclusion of latitude reduced the negative correlation between the allele frequency and annual radiation balance, but it still remained large and significant. The existence of correlations between the cline of CCR5 delta32 frequencies and climatic-geographic parameters suggest for an effect of either natural environmental factors or large-scale population movements on the distribution of this allele [6]. Distribution of CCR5 gene mutations in populations has distinct ethnic and racial features. The geographic cline of CCR5 delta32 frequencies and its recent emergence are consistent with a historic strong selective event such as an epidemic of a pathogen similar to HIV-1 that utilizes CCR5 therefore driving its frequency upward in ancestral Caucasian populations (Table 1) [11]. Frequency of CCR5 delta 32 allele in 16 European populations was found to form a gradient from north to south with the highest frequency of the allele in Denmark and lowest in Corsica [7]. Prevalence of CCR5 delta 32 outside of Europe is extremely low and in many non-European ethnic groups it is completely absent [9]. Distribution of allele frequencies of CCR5 delta 32 in Russia shows clinal variability from the north to the southeast, with the highest frequency in Pomors (Figure 1) [1]. Deletion of 32 base pairs of the C-C chemokine receptor type 5 was not detected in Yakut [2]. The prevalence of the CCR 5 delta 32 mutations in other ethnic groups of the Far North of Russia has not been previously determined. Objective To determine the prevalence of the CCR5 delta 32 mutation in the population of the Nenets. Based on the previously conducted studies, prevalence of CCR5 delta 32 mutation was expected to be significantly lower than in Europeans populations. Materials and methods The materials for the study were 54 blood samples (dried on filter paper) of Tundra Nenets children living in boarding Seyaha village, Yamal-Nenets Autonomous District. DNA was isolated using QIAamp Mini Kit (QIAGEN) according to the attached protocol. To identify deletions CCR5 delta32 used polymerase chain reaction with the flanking primers: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` under the following conditions 95˚-5'x1; [95˚-15»→55˚-15»→72˚-60»]x40; 72˚-10'x1→4˚-∞; products of the reaction were separated on 2 % agarose gels for 1.5 hours; gel documentation was carried out using a Gel Doc XR Plus (Bio-Rad). As a result of PCR amplification are produced two fragments 196 bp - wild type and 164 bp - delta32 mutation (Figure 2). Results CCR5 delta 32 mutation in heterozygous form was detected in 5 children, and homozygous mutations were not found at all. Therefore we found the prevalence of heterozygous form of CCR5 delta 32 mutation in Nenets population to be 9.3 %. Discussion/conclusion Prevalence of CCR5 delta32 mutation was expected to be significantly lower than among Europeans. However, the prevalence of the studied allele among Nenets living in the Yamal-Nenets Autonomous District, was close to the average prevalence among Europeans. Nenets belong to the so-called “Samoyed” people (corrupted self-reference Saamoa) which is the same as Saami (formerly Lapps or Lapons) in Finland (Suomi - the Finnish name for Finland), or transliterated into English Samodi. Saamoa speak the Samoyedic language which is a branch of the Uralic language family and it is known they moved from farther south in Siberia to the northernmost part of what later became Russia before the 12th century [12]. It is known that the allele CCR5 delta32 is rare in African, Asian, Middle Eastern, and American Indian populations, suggesting its recent origin [11]. It is assumed that high frequency of CCR5 delta32 mutation in Europe is a results of strong selection from bubonic plague (11). This hypothesis is popular in population genetic and medical literature, though quantitative assessment is absent. Three lines of evidence (predictions from a population genetic model, the geographical distribution of the allele, and the clinical effect of the deletion) indicate that the smallpox Variola major virus is a more likely candidate [13]. It is known that the population of people living in the northernmost part of Siberia declined tremendously after several outbreaks of smallpox [14], though little is known about the outbreaks of plague [14]. Our results support the hypothesis that the high frequency of the variant of this allele in European and in Yamal populations arose through strong selection from rather smallpox than from plague.

About the authors

Tatyana Ammosova

Howard University

Email: tatiana.ammosova@howard.edu
PhD, Assistant Research Professor, Howard University, College of Medicine

Andrey Sergeyevich Egorov

Saint Petersburg State Pediatric Medical University

Email: egorov.doc@gmail.com
MD, Research Fellow, Chair of Hospital Pediatrics

Elena Vladimirovna Fedorova

Saint Petersburg State Pediatric Medical University

Email: detymedic@mail.ru
MD, Research Fellow, Chair of Hospital Pediatrics

Sergey Lvovich Avrusin

Saint Petersburg State Pediatric Medical University

Email: avrusin4@gmail.com
MD, PhD, Associate Professor, Chair of Hospital Pediatrics

Andrey Vyacheslavovich Santimov

Saint Petersburg State Pediatric Medical University

Email: a.santimoff@gmail.com
MD, Research Fellow, Chair of Hospital Pediatrics

Sergei Nekhai

Howard University

Email: snekhai@howard.edu
Ph.D., Director, RCMI Proteomics Core Facility, Associate Professor, Center for Sickle Cell Disease. Howard University, College of Medicine

References

Supplementary files